This article is part of the series The tammar wallaby genome and transcriptome.

Open Access Research

Placental expression of pituitary hormones is an ancestral feature of therian mammals

Brandon R Menzies1*, Andrew J Pask2 and Marilyn B Renfree3

Author Affiliations

1 Leibniz Institute for Zoo and Wildlife Research, Alfred-Kowalke-Str 17, 10315, Berlin, Germany

2 Department of Molecular and Cell Biology, University of Connecticut Storrs, CN, USA

3 Department of Zoology, The University of Melbourne, 3010, Victoria, Australia

For all author emails, please log on.

EvoDevo 2011, 2:16 doi:10.1186/2041-9139-2-16


The electronic version of this article is the complete one and can be found online at: http://www.evodevojournal.com/content/2/1/16


Received:2 June 2011
Accepted:19 August 2011
Published:19 August 2011

© 2011 Menzies et al; licensee BioMed Central Ltd.

This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Background

The placenta is essential for supplying nutrients and gases to the developing mammalian young before birth. While all mammals have a functional placenta, only in therian mammals (marsupials and eutherians) does the placenta closely appose or invade the uterine endometrium. The eutherian placenta secretes hormones that are structurally and functionally similar to pituitary growth hormone (GH), prolactin (PRL) and luteinizing hormone (LH). Marsupial and eutherian mammals diverged from a common ancestor approximately 125 to 148 million years ago and developed distinct reproductive strategies. As in eutherians, marsupials rely on a short-lived but functional placenta for embryogenesis.

Results

We characterized pituitary GH, GH-R, IGF-2, PRL and LHβ in a macropodid marsupial, the tammar wallaby, Macropus eugenii. These genes were expressed in the tammar placenta during the last third of gestation when most fetal growth occurs and active organogenesis is initiated. The mRNA of key growth genes GH, GH-R, IGF-2 and PRL were expressed during late pregnancy. We found significant up-regulation of GH, GH-R and IGF-2 after the start of the rapid growth phase of organogenesis which suggests that the placental growth hormones regulate the rapid phase of fetal growth.

Conclusions

This is the first demonstration of the existence of pituitary hormones in the marsupial placenta. Placental expression of these pituitary hormones has clearly been conserved in marsupials as in eutherian mammals, suggesting an ancestral origin of the evolution of placental expression and a critical function of these hormones in growth and development of all therian mammals.

Background

Growth hormone (GH) is a fundamental regulator of normal post-natal growth in mammals and is also important to maintain lipid, carbohydrate, nitrogen, and mineral metabolism [1]. The GH gene has changed little during the evolution of mammals [2]. However, in higher primates and ruminant artiodactyls, the gene has undergone duplications, followed by rapid, independent spurts of evolution with the result that sequences from these species are highly dissimilar to all others [3]. Four GH-like genes exist in humans and include the three chorionic somatomammotropins (A, B and L) and one GH variant (GH-V or placental GH) all of which are produced exclusively by the placenta [4]. These genes share a high degree of sequence and structure similarity, consisting of five exons and four introns located in tandem on the long arm of chromosome 17, and each encode a mature protein of approximately 190 to 200 amino acids [4]. Interestingly, exon 3 of the GH receptor (GH-R), which is responsible for extra-cellular binding and transmission of the GH signal, is not present in marsupials or monotremes [5]. While this does not affect post-natal growth, the exon 3 sequences of eutherian mammals with placental variants of GH and PRL are much more variable than those without placental hormone variants. Human GH-V has recently been shown to play an important role in trophoblast invasion into the endometrium by stimulating its receptor GH-R [6].

In sheep, there are two allelic variations of the growth hormone gene. The GH-1 allele contains one copy of pituitary GH while the GH-2 allele contains two tandem copies of the GH gene designated GH2-N and GH2-Z [7]. GH2-N codes for pituitary GH while GH2-Z contains three amino acid substitutions and is expressed only in the sheep placenta. While the GH-2 allele appears to be more frequent in sheep populations than that of GH-1, animals that are homozygous or heterozygous for either allele still produce pituitary GH in the placenta and there are no growth differences between fetuses of varying allelic composition [7]. While the goat has a similar makeup of GH genes, having shared a common ancestor with the sheep approximately 5 million years ago, there is also evidence for duplicate GH genes in the chevrotain, red deer, giraffe and hippopotamus [2]. However, it is unknown whether these individual duplications are homologous to the other groups.

Eutherian mammals such as rodents and cows have evolved specific prolactin variants that are expressed in the placenta. A total of 21 such genes exist in rodents and 8 in the cow [8]. Within the Rodentia, many of these variants are assumed to be orthologues. However, the cow and rodent variants are not orthologous, demonstrating the independent duplication and divergence of these sequences.

Placental expression of pituitary hormone variants including GH, PRL and LH-β (of which human chorionic gonadotropin (HCG) provides the first signal of an ensuing pregnancy from the human conceptus), likely originate from tissue specific expression by the conceptus or the placenta, followed by gene duplication of the original gene for a specific function. If this is correct, then the placentas of a diverse array of mammals would be expected to produce the pituitary form of these hormones for generalized functions in pregnancy. Marsupials provide an ideal model in which to examine the evolution of these genes. Marsupials have a fully functional but short-lived placenta that elaborates at least some hormones [9]. However, the highly altricial young that are delivered after a very short pregnancy complete their development over an extended lactational period, either in a pouch or a nest [10]. Eutherians and marsupials last shared a common ancestor 125 to 147 million years ago [11,12] so it is possible to determine whether placental expression and gene duplication was a common feature of the ancestral mammal or was a more recent evolutionary event that occurred only in the eutherian lineage.

The first marsupial pituitary GH sequence was isolated in the brushtail possum, Trichosurus vulpecula [13] and shares considerable sequence identity with pig and horse GHs (species in which GH is highly conserved) with approximately 87% protein identity. This suggests a conserved rate of GH evolution in marsupials similar to that described for the majority of mammals [2,13]. The possum prolactin and red kangaroo LH-β sequences have also been isolated and share considerable protein identity with other mammals [14,15].

Pituitary GH sequences have been cloned from a broad group of mammals. However, comparisons with placental GH, PRL and LH have mainly been examined in cow, sheep, rat, mouse, human and other primates [8]. Thus, expression of these important hormones appears to be a general feature of eutherians and, as in humans, may be providing diverse functions in metabolism and pregnancy recognition. No marsupials have been examined as yet, and almost nothing is known of the conservation and expression of pituitary hormones in any non-eutherian mammal. This study therefore investigates the sequence composition and expression of the pituitary hormones GH, PRL, and LH-β in the placenta of a marsupial the tammar wallaby Macropus eugenii. We have also quantified expression in the trilaminar placenta over the last third of pregnancy when active organogenesis occurs.

Results

Isolation and expression of pituitary genes in the tammar placenta

First we isolated the pituitary sequence of GH to establish whether there was any sequence variation indicative of placental variants. Pituitary GH was amplified and sequenced in the adult tammar (n = 2; both male). It had considerable protein identity with the brushtail possum (99%; Table 1) and other mammals. The same primer set (Table 2) was used to amplify and sequence this gene from the placenta at day 23 of gestation (675 base pairs; Figure 1). The resulting sequence spanned numerous introns and covered the whole open reading frame (ORF). There were no sequence differences between wallaby pituitary and placental GH. Next, we analyzed placental tissue for the GH receptor. Full length GH-R cDNA was previously cloned from the livers of adult tammars and their pouch young [5]. There was no variation in the GH-R mRNA sequence in the bilaminar (BYS) and trilaminar (TYS) placenta compared to that of the liver GH-R mRNA. There was strong expression of GH and GH-R in both the tri- and bilaminar placenta from day 18 to 25 of pregnancy (189 base pairs; Figure 1).

Table 1. Protein alignment values for the tammar GH, PRL, and LH- β genes compared to other marsupial and eutherian mammals

Table 2. Genes, primers, annealing temperatures (Tm) and number of PCR cycles used to amplify specific genes

thumbnailFigure 1. Quantitative expression of GH, GH-R, IGF-2 and PRL in the trilaminar yolksac placenta. Relative mRNA expression of the growth genes GH, GH-R and IGF-2 all increased significantly compared to β-actin after shell coat rupture in the tammar placenta. This period of pregnancy is characterized by rapid fetal growth and development prior to birth of the altricial young (n = 3 to -6 per stage; letters indicate significant differences P < 0.05; there were no significant changesin prolactin (PRL) expression over this period; GH, growth hormone; GH-R, growth hormone receptor; IGF-2, insulin-like growth factor-2).

The mRNAs for PRL and LH-β were also first isolated from the pituitary in order to compare these sequences with placental isolates. Both of these sequences shared considerable protein identity with that of the brushtail possum (97% each; Table 1; Additional file 1, Figure S1) and other mammals. The inferred PRL protein had many conserved structural features including 6 cysteine residues which form 3 disulfide bridges that are important for the 3-dimensional structure of the protein, as well as 15 amino acids which are necessary for receptor binding [16]. Similarly, the inferred LH-β glycoprotein contained several conserved elements including cysteine residues necessary for binding to the LH-α chain (Additional file 2, Figure S2). Placental PRL and LH-β mRNA were expressed from day 18 to 25 of pregnancy in both tri- and bilaminar yolk sac placenta (652 and 509 base pairs, respectively; Figure 1; Figure 2). The placental mRNA sequences for PRL and LH-β encompassed most of the ORFs of these genes similar to GH and spanned multiple introns. Placental PRL and LH-β isolates were identical to the pituitary isolates.

Additional file 1. Figure S1: Alignment of the predicted protein sequence for tammar prolactin. The PRL precursor was highly conserved between vertebrate species including the six cysteine residues (indicated by the red letters) at positions 33, 40, 87, 203, 220, and 228 relative to the wallaby. These amino acids form three disulfide bonds contributing to the three-dimensional structure of the mature protein. There are 14 amino acids (identified by asterisks) in mammals which are necessary for GH receptor binding site 1. All of these amino acids are conserved in the tammar. Additionally, Ala51 and Gly158 (indicated by the black arrows) are necessary for binding at site 2 and these are also conserved in the tammar and other vertebrates.

Format: PPT Size: 223KB Download file

This file can be viewed with: Microsoft PowerPoint ViewerOpen Data

Additional file 2. Figure S2: Predicted protein sequence for tammar luteinizing hormone β subunit. The protein sequences for both sub units (α and β) have already been described for the red kangaroo [15]. The predicted tammar sequence was identical to the red kangaroo except for an additional leucine at position 14 relative to the tammar.

Format: PPT Size: 89KB Download file

This file can be viewed with: Microsoft PowerPoint ViewerOpen Data

thumbnailFigure 2. LH-β expression in the tammar wallaby placenta. mRNA gene expression in placental tissue from days 18 to 25 of pregnancy in the tammar wallaby. The isolation and expression of this pituitary gene in the marsupial placenta suggests that orthologues of these genes may be found in the placentas of all mammals. (BYS: bilaminar yolk sac; La: DNA Ladder; TYS: trilaminar yolk sac; -ve: negative control).

Quantitative expression of GH, GH-R and IGF-2

Expression of the growth genes GH, GH-R and IGF-2 were all low during the period of shell coat rupture (day 18; Figure 1). After the loss of the shell coat (Figure 3), attachment and interdigitation of the trophoblast with the uterine epithelium, expression increased significantly for GH and IGF-2, reaching a peak at days 24 and 21 of pregnancy, respectively. The increases in GH-R expression after attachment were not significant, although higher than those observed during the final two days of pregnancy (Figure 1). PRL expression declined over all the stages analyzed, but there were no significant differences in expression from day 18 to day 25 of pregnancy (Figure 1).

thumbnailFigure 3. Growth and development of the tammar embryo and fetus. (a) At day 18, the conceptus emerges form the ruptured shell coat (Sh) so that the two regions of the placenta can make a close attachment to the uterine epithelium. The right side of the embryo is already coat-free, while the embryo itself is still within the shell coat. (b) The d18 embryo free of the fetal membranes, clearly distinguishing between the vascular and non-vascular regions of the yolk sac (BYS: bilaminar yolk sac; TYS trilaminar yolk sac; ST sinus terminalis). (c) Fetus at day 23 of pregnancy, showing the increase in the vascular region and the close attachment of the placenta to the uterine epithelium (Ut). The vitelline vessels are prominent. (d) Full term fetus at day 25 of pregnancy, about a day before birth. The allantois (All) is large but held within the folds of the yolk sac, which has become highly vascular. The fetus has well developed fore limbs ready for the climb to the pouch and the tongue is typically protruded (Am: amniopore).

Discussion

The tammar placenta produces the pituitary hormones GH (and its receptor), PRL and LH-β. Until recently, marsupial placentas were thought to produce only limited hormones, but their presence at least in the tammar suggests that these endocrine factors may be intrinsic to normal pregnancy and preparation for lactation in all mammals. These results also extend previous data indicating an important role for IGF2 in the marsupial placenta.

There is now considerable evidence in both sub-classes of therian mammals (the eutherians and the marsupials) that the feto-placental unit produces local and systemic effects on the reproductive tract that result in a maternal recognition of pregnancy [17-20]. In macropodid marsupials, these responses include increases in size and secretory activity of the gravid versus non-gravid endometrium, as a direct result of the presence of a developing embryo [20-23]. It was hypothesized that the fetal effect may be due to either an endocrine factor or to an inflammatory effect [17,20]. This embryonic signal may be LH-β, or more correctly, a chorionic gonadotrophin as the placental specific product is designated in eutherian mammals. Preliminary evidence for a bioassayable chorionic gonadotrophin was obtained with a bioassay (MB Renfree and L. Wide, unpublished results) but this was never investigated further.

The present study confirms that LH-β is synthesised by the placenta, and suggests that this, together with GH and PRL, may be responsible for the observed stimulation of the uterine endometrium to maintain pregnancy. It also establishes that these pituitary hormones may be a shared ancestral feature of the therian mammalian placenta (Figure 4).

thumbnailFigure 4. Origin of pituitary hormone expression in the mammalian placenta. Expression of the pituitary hormones GH, GH-R, PRL and LH-β in the yolk-sac placenta of the tammar wallaby suggest that these hormones may have provided a general function in the placenta of the common ancestor of therian mammals (blue dot). From this generalized expression, the placentas of some eutherian mammals including humans have developed specific gene copies including HCG, GH-V (red dots; NV indicates no sequence variants in those species; GH, growth hormone; GH-R, growth hormone receptor; GH-V, growth hormone variant; HCG, human chorionic gonadotrophin; LH-β, luteinizing hormone subunit-β; PRL, prolactin; NV, no variants).

PRL and LHreceptors are present in the brushtail possum ovary [24], and PRL receptors are under strict regulation during pregnancy in the tammar wallaby corpus luteum and mammary gland [25]. However, there is a prolactin pulse about eight hours before parturition in the tammar which is essential for the establishment of lactation [26,27], but this cannot derive from the placenta because placental PRL mRNA is at its lowest before birth. Placental PRL can stimulate the endometrium to support the embryo and fetus in domesticated species such as the sheep [28]. However, given the low levels of expression in the tammar placenta, absence of significant quantitative changes during attachment and low levels of PRL receptor expression in the endometrium relative to the corpus luteum (H. Clark personal communication) it is unlikely to have a similar function in the tammar.

To date, only a few endocrine signals from the marsupial placenta have been detected, including prostaglandin F2α, relaxin, insulin and IGF-2 [29-32], as well as incipient steroid production [33-35]. The isolation of GH, GH-R, PRL and LH-β from the placenta of a marsupial shows that it is a much more complex organ than initially thought. The placental tissues in this study were examined between days 18 to 26 of pregnancy, the period between the first attachment of the yolk-sac placenta (day 18 of pregnancy) and full term (birth: day 26 to 27) when this tissue is likely to be most metabolically active. Before this period (that is, blastocyst to late vesicle stage), there is no evidence that the embryo provides a signal to the uterus as it is surrounded by a shell coat produced by the oviducal and uterine epithelial cells, and both uteri respond to the increased circulating progesterone to stimulate the uterine epithelium to become secretory [20,21,36,37]. Once the shell coat ruptures, the embryo makes a close interdigitation with the uterine epithelium and maternal blood supply. The fetus develops rapidly and organogenesis is complete by the time of birth only nine days later [10,38]. IGF-2 and GH are good candidates to facilitate this rapid growth.

IGF-2 is maternally imprinted in the tammar placenta, similar to all other eutherian species so far investigated [39]. The presence of genomic imprinting suggests that IGF-2 plays a dominant role in the sequestration of maternal resources for the fetus. However, the up-regulation of other important growth genes such as GH and its receptor suggests that the marsupial placenta is not simply an inert tissue capable of transferring uterine secretions to the fetus but, like that of eutherian mammals, must actively grow and secrete critical hormones so it can nourish the continued growth of the conceptus.

Conclusions

The discovery of somatotropins and gonadotropins in the yolk-sac placenta of the tammar wallaby supports the growing knowledge about marsupial placental function and demonstrates that the marsupial placenta is a fully functional and complex organ of physiological exchange between mother and fetus. It also suggests an ancestral role for these hormones in the reproduction of all mammals.

Methods

Animals

Tammar wallabies of Kangaroo Island origin were maintained in our breeding colony in large grassy outdoor enclosures. Their grass diet was supplemented with lucerne cubes and vegetables while drinking water was provided ad libitum. All experimentation was approved by the University of Melbourne Institutional Animal Ethics Committees and conformed to the Australian National Health and Medical Research council (2004) guidelines.

Tissue collection

Whole placentas were taken opportunistically from fetuses collected for other experiments. Both bilaminar and trilaminar regions of the placenta were carefully dissected away from the fetus and endometrium and placed into RNA-free cryotubes, snap-frozen in liquid nitrogen and stored at -80°C.

RNA extraction and gene cloning

Total RNA was extracted from 50 mg to 200 mg of placental tissue using RNAwiz (Ambion, Austin USA) according to the manufacturer's protocol. RNA quality was assessed by electrophoresis on ethidium bromide gel and detection of clean 18 and 24 S bands. Intact samples were DNAse treated using a DNAfree kit (Ambion, Austin USA) and stored in RNA secure water at -80°C. RNA concentrations were determined using a NanoDrop Spectrophotometer (Thermo Scientific, Wilmington USA) after which precisely 1 μg of total RNA was treated using the Superscript III First Strand Synthesis System for RT-PCR (Invitrogen, Carlsbad USA) to generate complimentary DNA (cDNA). Full length sequences were obtained by reverse transcriptase PCR using placental cDNA, GoTaq (Promega, Madison USA) master mix and primers from conserved regions of the brush-tailed possum sequences (GH: AF052192; PRL: AF054634; LH-β: AF017448; GH-R:AF467545). The specificity of these transcripts was then confirmed by BLAST homology and identification in the tammar wallaby trace archives in NCBI (GenBank accession numbers: GH: EU918392; GH-R: EU682376; LH-β: FJ434244; PRL: FJ434245). Species specific primers were then designed from the full length GH sequence for use in qPCR analysis. QPCR primers for IGF-2 were replicated from Ager et al (2008) [31]. Primers were designed to span introns so that only cDNA was detected as confirmed by gel electrophoresis. QPCR was performed using the Quantitec Sybr Green PCR Kit (Qiagen, Germantown USA) and reactions run in triplicate on an Opticon 2 Monitor (MJ Research, Waltham USA). The quantity of transcripts from the genes of interest were compared to the housekeeping gene β-actin Fwd, TTGCTGACAGGATGCAGAAG, Rev, AAAGCCATGCCAATCTCATC by comparison of amplification thresholds using Opticon 2 Monitor software. All primers were purchased from Sigma-Aldrich and qPCR products confirmed by BLAST using the least stringent parameters in NCBI. Transcripts were sequenced at the Gandel Charitable Trust Sequencing Centre (Monash University). Primer sequences, annealing temperatures and PCR cycle lengths can be found in Table 2.

The protein sequences of LHβ and PRL are provided in Additional file 1, Figure S1 and Additional file 2, Figure S2. The sequence of GH [40], GH-R [5] and IGF2 [38] were previously published.

Statistics

Expression analysis of the pituitary hormones GH, GH-R and LH-β by standard PCR were repeated in BYS and TYS samples from three different individuals at days 18, 21, 23, 24 and 25 of pregnancy. Quantitative analysis was performed on TYS samples (Four to six per stage) also from days 18, 21, 23, 24 and 25 of pregnancy. Analysis of variance and multiple comparison tests were performed using Systat Version 13 and statistically significant outcomes reported as P < 0.05. Data are presented as means ± s.e.m.

List of abbreviations

BYS: bilaminar yolk-sac; GH: growth hormone; GH-R: growth hormone receptor; IGF-2: insulin-like growth factor-2; LH-β: luteinizing hormone subunit-β; PRL: prolactin; TYS: trilaminar yolk-sac.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

MBR and BRM conceived the experiments. MBR collected and dissected the tissues. BRM performed the molecular analyses. AJP assisted with the analyses. All authors contributed to the intellectual design of the experiments and the writing of the manuscript. All authors read and approved the final manuscript.

Acknowledgements

We thank Helen Clark for technical support with this project. This research was supported by an Australian Research Council (ARC) Centre of Excellence in Kangaroo Genomics, an ARC Federation Fellowship to MBR and a National Health and Medical Research Council RD Wright Fellowship to AJP.

References

  1. Frago LM, Chowen JA: Basic Physiology of the Growth Hormone/Insulin-Like Growth Factor Axis. In The Growth Hormone/Insulin Like Growth Factor Axis During Development. Edited by Varela-Nieto I, Chowen JA. New York: Springer; 2005:1-15.

  2. Forsyth IA, Wallis M: Growth hormone and prolactin--molecular and functional evolution.

    J Mammary Gland Biol Neoplasia 2002, 7:291-312. PubMed Abstract | Publisher Full Text OpenURL

  3. Wallis M: The molecular evolution of vertebrate growth hormones: a pattern of near-stasis interrupted by sustained bursts of rapid change.

    J Mol Evol 1996, 43:93-100. PubMed Abstract | Publisher Full Text OpenURL

  4. Baumann G: Growth hormone heterogeneity: genes, isohormones, variants, and binding proteins.

    Endocr Rev 1991, 12:424-449. PubMed Abstract | Publisher Full Text OpenURL

  5. Menzies BR, Shaw G, Fletcher TP, Renfree MB: Exon 3 of the growth hormone receptor (GH-R) is specific to eutherian mammals.

    Mol Cell Endocrinol 2008, 296:64-68. PubMed Abstract | Publisher Full Text OpenURL

  6. Lacroix MC, Guibourdenche J, Fournier T, Laurendeau I, Igout A, Goffin V, Pantel J, Tsatsaris V, Evain-Brion D: Stimulation of human trophoblast invasion by placental growth hormone.

    Endocrinology 2005, 146:2434-2444. PubMed Abstract | Publisher Full Text OpenURL

  7. Wallis M, Lioupis A, Wallis OC: Duplicate growth hormone genes in sheep and goat.

    J Mol Endocrinol 1998, 21:1-5. PubMed Abstract | Publisher Full Text OpenURL

  8. Soares MJ: The prolactin and growth hormone families: pregnancy-specific hormones/cytokines at the maternal-fetal interface.

    Reprod Biol Endocrinol 2004, 2:51. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text OpenURL

  9. Renfree MB: Marsupials: Placental Mammals with a Difference.

    Placenta 2010, 31:S21-26. PubMed Abstract | Publisher Full Text OpenURL

  10. Tyndale-Biscoe CH, Renfree MB: Reproductive Physiology of Marsupials. Cambridge: Cambridge University Press; 1987. OpenURL

  11. Bininda-Emonds OR, Cardillo M, Jones KE, MacPhee RD, Beck RM, Grenyer R, Price SA, Vos RA, Gittleman JL, Purvis A: The delayed rise of modern day mammals.

    Nature 2007, 446:507-512. PubMed Abstract | Publisher Full Text OpenURL

  12. Luo ZX, Ji Q, Wible JR, Yuan CX: An early cretaceous tribosphenic mammal and metatherian evolution.

    Science 2003, 302:1934-1940. PubMed Abstract | Publisher Full Text OpenURL

  13. Saunders MC, Deakin J, Harrison GA, Curlewis JD: cDNA cloning of growth hormone from the brushtail possum (Trichosurus vulpecula).

    Gen Comp Endocrinol 1998, 111:68-75. PubMed Abstract | Publisher Full Text OpenURL

  14. Curlewis JD, Saunders MC, Kuang J, Harrison GA, Cooper DW: Cloning and sequence analysis of a pituitary prolactin cDNA from the brushtail possum (Trichosurus vulpecula).

    Gen Comp Endocrinol 1998, 111:61-67. PubMed Abstract | Publisher Full Text OpenURL

  15. Harrison GA, Deane EM, Cooper DW: cDNA cloning of luteinizing hormone subunits from brushtail possum and red kangaroo.

    Mamm Genome 1998, 9:638-642. PubMed Abstract | Publisher Full Text OpenURL

  16. Goffin V, Shiverick KT, Kelly PA, Martial JA: Sequence-function relationships within the expanding family of prolactin, growth hormone, placental lactogen, and related proteins in mammals.

    Endocr Rev 1996, 17:385-410. PubMed Abstract | Publisher Full Text OpenURL

  17. Renfree MB: Maternal recognition of pregnancy in marsupials.

    Rev Reprod 2000, 5:6-11. PubMed Abstract | Publisher Full Text OpenURL

  18. Smith R, Mesiano S, McGrath S: Hormone trajectories leading to human birth.

    Regul Pept 2002, 108:159-64. PubMed Abstract | Publisher Full Text OpenURL

  19. Short RV: From Implantation and the maternal recognition of pregnancy. In CIBA Foundation Symposium on Foetal Autonomy. Edited by Wolstenholme GEW, O'Connor M. London: Churchill; 1969:2-26. OpenURL

  20. Renfree MB: Influence of the embryo on the marsupial uterus.

    Nature 1972, 240:475-477. PubMed Abstract | Publisher Full Text OpenURL

  21. Renfree MB, Tyndale-Biscoe CH: Intrauterine development after diapause in the marsupial Macropus eugenii.

    Dev Biol 1973, 32:28-40. PubMed Abstract | Publisher Full Text OpenURL

  22. Tyndale-Biscoe CH: Hormonal control of embryonic diapause and reactivation in the tammar wallaby. In Maternal Recognition of Pregnancy. Edited by the CIBA Foundation Symposium Editor. Amsterdam: CIBA Foundation Symposium, Exerpta Medica; 1979:172-190. OpenURL

  23. Renfree MB, Tyndale-Biscoe CH: Intrauterine development after diapause in the marsupial, Macropus eugenii.

    Dev Biol 1973, 32:28-40. PubMed Abstract | Publisher Full Text OpenURL

  24. Eckery DC, Lun S, Thomson BP, Chie WN, Moore LG, Juengel JL: Ovarian expression of messenger RNA encoding the receptors for luteinizing hormone and follicle-stimulating hormone in a marsupial, the brushtail possum (Trichosurus vulpecula).

    Biol Reprod 2002, 66:1310-1317. PubMed Abstract | Publisher Full Text OpenURL

  25. Sernia C, Tyndale-Biscoe CH: Prolactin receptors in the mammary gland, corpus luteum and other tissues of the tammar wallaby, Macropus eugenii.

    J Endocrinol 1979, 83:79-89. PubMed Abstract | Publisher Full Text OpenURL

  26. Hinds LA, Tyndale-Biscoe CH: Prolactin in the marsupial Macropus eugenii, during the oestrous cycle, pregnancy and lactation.

    Biol Reprod 1982, 26:391-398. PubMed Abstract | Publisher Full Text OpenURL

  27. Fletcher TP, Shaw G, Renfree MB: Effects of bromocriptine at parturition in the tammar wallaby, Macropus eugenii.

    Reprod Fertil Dev 1990, 2:79-88. PubMed Abstract | Publisher Full Text OpenURL

  28. Spencer TE, Bazer FW: Uterine and placental factors regulating conceptus growth in domestic animals.

    J Anim Sci 2004, 82(E-Suppl):E4-13. PubMed Abstract | Publisher Full Text OpenURL

  29. Parry LJ, Renfree MB: Onset of relaxin gene expression in the tammar wallaby placenta.

    Biol Reprod Suppl 1999, 60:25. OpenURL

  30. Shaw G, Gehring HM, Bell EC: Production of prostaglandin F2alpha and its metabolite by endometrium and yolk sac placenta in late gestation in the tammar wallaby, Macropus eugenii.

    Biol Reprod 1999, 60:611-614. PubMed Abstract | Publisher Full Text OpenURL

  31. Ager E, Pask AJ, Renfree MB: Expression and protein localisation of IGF2 in the marsupial placenta.

    BMC Dev Biol 2008, 8:17. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text OpenURL

  32. Ager E, Suzuki S, Pask J, Shaw G, Ishino F, Renfree MB: Insulin is imprinted in the placenta of the marsupial, Macropus eugenii.

    Dev Biol 2007, 309:317-328. PubMed Abstract | Publisher Full Text OpenURL

  33. Renfree MB, Heap RB: Steroid metabolism by the placenta, corpus luteum, and endometrium of the marsupial Macropus eugenii.

    Theriogenology 1977, 8:164. Publisher Full Text OpenURL

  34. Heap RB, Renfree MB, Burton RD: Steroid metabolism in the yolk sac placenta and endometrium of the tammar wallaby, Macropus eugenii.

    J Endocr 1980, 87:339-349. PubMed Abstract | Publisher Full Text OpenURL

  35. Renfree MB: Endocrine activity in marsupial placentation. In Endocrinology 1980. Edited by Cumming IA, Funder JW, Mendelsohn FAO. Canberra: Australian Academy of Science; 1980:83-86. OpenURL

  36. Renfree MB: Proteins in the uterine secretions of the marsupial, Macropus eugenii.

    Dev Biol 1973, 32:41-49. PubMed Abstract | Publisher Full Text OpenURL

  37. Tyndale-Biscoe CH, Hearn JP, Renfree MB: Control of reproduction in macropodid marsupials.

    J Endocr 1974, 63:589-614. PubMed Abstract | Publisher Full Text OpenURL

  38. Renfree MB: The composition of fetal fluids of the marsupial, Macropus eugenii.

    Dev Biol 1973, 33:62-79. PubMed Abstract | Publisher Full Text OpenURL

  39. Suzuki S, Renfree MB, Pask AJ, Shaw G, Kobayashi S, Kohda T, Kaneko-Ishino T, Ishino F: Genomic imprinting of IGF-2, p57(KIP2) and PEF1/MEST in a marsupial, the tammar wallaby.

    Mech Dev 122:213-222. OpenURL

  40. Menzies BR, Shaw G, Fletcher TP, Renfree MB: Early onset of ghrelin production in a marsupial.

    Mol Cel Endocrinol 2009, 299:266-273. Publisher Full Text OpenURL